|
|
|
|
|
|
|
||
Article |
 |
ABSTRACT |
|---|
 Top ABSTRACT introductionmethodsresultsdiscussionreferences |
|---|
, β, and 
; each subunit contains only two transmembrane domains. The level of expression of each of the subunits is markedly different in various Na+ absorbing epithelia raising the possibility that channels with different subunit composition can function in vivo. We have examined the functional properties of channels formed by the association of with β and of with in the Xenopus oocyte expression system using two-microelectrode voltage clamp and patch-clamp techniques. We found that β channels differ from channels in the following functional properties: (a) β channels expressed larger Na+ than Li+ currents (INa+/ILi+ 1.2) whereas channels expressed smaller Na+ than Li+ currents (INa+/ILi+ 0.55); (b) the Michaelis Menten constants (Km) of activation of current by increasing concentrations of external Na+ and Li+ of β channels were larger (Km > 180 mM) than those of channels (Km of 35 and 50 mM, respectively); (c) single channel conductances of β channels (5.1 pS for Na+ and 4.2 pS for Li+) were smaller than those of channels (6.5 pS for Na+ and 10.8 pS for Li+); (d) the half-inhibition constant (Ki) of amiloride was 20-fold larger for β channels than for channels whereas the Ki of guanidinium was equal for both β and . To identify the domains in the channel subunits involved in amiloride binding, we constructed several chimeras that contained the amino terminus of the subunit and the carboxy terminus of the β subunit. A stretch of 15 amino acids, immediately before the second transmembrane domain of the β subunit, was identified as the domain conferring lower amiloride affinity to the β channels. We provide evidence for the existence of two distinct binding sites for the amiloride molecule: one for the guanidium moiety and another for the pyrazine ring. At least two subunits with β or contribute to these binding sites. Finally, we show that the most likely stoichiometry of β and channels is 1:1β and 1:1, respectively.
Key Words: epithelial Na+ channel • amiloride • guanidinium • Xenopus oocyte
|
introduction |
|---|
|
TopABSTRACTintroductionmethodsresultsdiscussionreferences |
|---|
; Rossier et al., 1994). Na+ channels are located in the apical membranes of epithelia such as the distal nephron and colon, the ducts of salivary and sweat glands, and the respiratory tract. Molecular cloning of ENaC has revealed that the channel is formed by three homologous subunits, , β, and (Canessa et al., 1994), that share 34–37% identity at the amino acid level. Expression of the three subunits in a heterologous system such as Xenopus oocytes reconstitutes channels with properties similar to those present in native tissues: high selectivity of sodium over potassium (PNa+/PK+ > 20), half-inhibition constant (Ki) of amiloride of 0.10 µM, and only a slight voltage dependence of the open probability (Hamilton and Eaton, 1985; Palmer and Frindt, 1986; Canessa et al., 1994). Canessa et al. (1994) have previously shown that co- expression of , β, and subunits is necessary to induce maximal levels of channel activity. Single subunits produce amiloride-sensitive currents of small magnitude ( subunit expressed alone induces only 1% of the maximal whole-cell current) or no current at all (β or expressed alone or co-expression of the two subunits do not induce any current). However, co-expression of and β subunits or of and subunits results in about 15–20% of the maximal magnitude of amiloride-sensitive whole cell current.
The total number of subunits and the stoichiometry of the subunits in ENaC have not yet been determined. Additionally, it is not known whether the subunit composition can be varied to give channels with different functional properties. The physiological relevance of channels of different subunit composition is supported by the observation that not all Na+ absorbing epithelia express the three subunits of ENaC. In the lung there is a heterogeneity of expression with some cells having only and subunits (Farman et al., 1997); in colonic epithelia, in the absence of stimulation by aldosterone, only the subunit is expressed (Lingueglia et al., 1994; Asher et al., 1997). These findings raise the possibility that, at least in certain tissues, only one or two ENaC subunits may be sufficient to form functional sodium channels in vivo.
Because little is known about the properties of channels that consist of only two of the ENaC subunits, we describe the expression and functional properties of channels formed by the combination of and β and of and subunits. We found that β and channels differ in sensitivity to the blocker amiloride, Km values for activation by external Na+ and Li+, and single channel conductances. Maximal currents were observed when the cRNAs injected of and β, and and were of 1:1 ratio; large variations from this ratio decreased the magnitude of the amiloride-sensitive currents, but the distinct functional properties of the β and channels were maintained suggesting that the most likely stoichiometry of β and channels is 1:1β and 1:1, respectively. In addition, we identified a short stretch of amino acids before the second transmembrane domain that determines amiloride affinity. We discuss a model that describes the presence of at least two distinct binding sites for the amiloride molecule, one site for the guanidinium moiety and another for the pyrazine ring.
|
methods |
|---|
|
TopABSTRACTintroductionmethodsresultsdiscussionreferences |
|---|
. Capped cRNAs were transcribed in vitro from linearized cDNAs using SP6 RNA polymerase. Stage V-VI Xenopus oocytes were isolated by partial ovariectomy under tricaine anesthesia and then defolliculated by treatment with 1 mg/ml collagenase (Type 1A; Sigma Chemical Co., St. Louis, MO) in zero Ca2+ modified Barth's solution (MBS), containing in mmol/liter: 85 NaCl, 2.4 NaHCO3, 1 KCl, 0.8 MgSO4, 0.3 Ca(NO3), 0.4 CaCl2, and 5 HEPES (buffered to pH 7.2) for 1 h at room temperature. 2–24 h after defolliculation, oocytes were injected with 1–3 ng of each cRNA in a final volume of 50 nl. The amount of injected cRNA was changed to obtain five conditions with different ratios of and β, or of and cRNAs. Condition 10:1β received 3 ng of and 0.3 ng of β; condition 5:1β received 3 ng of and 0.6 ng of β; condition 1:1β received 3 ng each of and β; condition 1:5β received 0.6 ng of and 3 ng of β, and condition 1:10β received 0.3 ng of and 3 ng of β. Similar experimental protocols were used for the five corresponding conditions. In experiments where the β-dimer was injected, oocytes received 1 ng of β-dimer cRNA alone or in addition to 1, 2, or 3 ng of cRNA or 1, 2, or 3 ng of β cRNA. In experiments where the -dimer was injected, oocytes received 1 ng of -dimer cRNA alone or in addition to 1, 2, or 3 ng of cRNA or 1, 2, or 3 ng of cRNA. Oocytes were kept in MBS with 1.8 mM Ca2+, supplemented with penicillin (100 U/ml) and streptomycin (100 µg/ml) for 3–5 d at 19°C before experiments.
Electrophysiology
Oocyte whole-cell currents were measured using the two-microelectrode voltage clamp technique (Oocyte Clamp C-725B; Warner Instrument Corp., Hamden, CT). Epithelial sodium channel currents were calculated as the difference in whole-cell current before and after the addition of 100 µM amiloride to the bathing solution. The bath solution contained in mmol/liter: 1.8 CaCl2; 2 MgCl2; 4 KCl; 5 BaCl2; 5 HEPES, buffered to pH 7.2, and 0–150 mM Na+, Li+, or K+ gluconate. NMDG-gluconate (N -methyl- D-glucamine) was used to make the total concentration of cation-gluconate 150 mM. Pulse software (HEKA Elektronik, Lambrecht, Germany) was used to generate voltage pulses. To obtain I-V curves, the membrane potential was changed from –180 to 80 mV by 20-mV incremental steps of 200-ms duration. Data were collected and analyzed with a Power Macintosh computer.
The Kms for external Na+ and Li+ were calculated from the amiloride-sensitive component of whole-cell currents (I) induced by varying the concentration (C) of Na+ or Li+ in the bath solution from 0 to 150 mM. The data were fitted to the Michaelis-Menten equation:
 | (1) |
where Imax is the maximal current and Km is the half-activation constant using a nonlinear fit program based on the simplex method.
Dose-response curves for the blockers amiloride, benzamil, and guanidinium were obtained by measuring the change in current induced by adding increasing concentrations of blocker into the bath solution. The data were fitted to the equation:
 | (2) |
where A is the concentration of the blocker and Ki is the inhibition constant. To assess the voltage dependence of amiloride block, the Ki was measured at various membrane holding potentials ranging from –180 to 50 mV. As indicated, in certain experiments the Ki of amiloride was measured in the presence of 150 or 30 mM Na+ in the bathing solution. Results are expressed as mean ± standard error (SEM), n = number of observations.
Patch Clamp Technique
Single channel recordings were obtained from membrane patches from Xenopus oocytes (Methfessel et al., 1986) injected with either (, β, and ), ( and ), or ( and β) rat ENaC cRNAs. Recording pipettes were constructed from borosilicate glass capillaries (Dagan Corp., Minneapolis, MN) using a Narishige PP83 microelectrode puller (Narishige Scientific Instrument Laboratory, Tokyo, Japan) and were not fire polished. The pipettes had tip resistances of 2–5 M
and were partially filled with solutions containing, in mmol/liter: 150 NaCl or LiCl; 1 CaCl2; 1 MgCl2; 5 HEPES, buffered to a final pH of 7.4. Bath solutions contained, in mmol/liter: 150 NaCl or LiCl; 5 EDTA; 5 HEPES, buffered to a final pH of 7.4. Experiments were performed at room temperature (
20–22°C).
Single channel currents were recorded from cell-attached patches with a patch clamp amplifier (Model EPC-7; List Electronics, Darmstadt, Germany, or Model PC-505; Warner Instrument Corp.). The signal was low pass filtered at 500 Hz with an 8-pole bessel filter and stored on video tape after pulse code modulation (Model PCM-501ES; Sony, Tokyo, Japan). For analysis, data were re-digitized (2 kHz), transferred to a PC, and analyzed using the pCLAMP6 (Axon Instruments Inc., Burlingame, CA) software system. Data were then filtered at 30–100 Hz for analysis and display. Single channel conductance was estimated with linear regression analysis from currents measured from –100 and –40 mV.
Construction of cDNAs
Chimeras of and β rat ENaC cDNAs were generated by a two-step PCR protocol. CH1 was constructed by amplification of wild-type template using a complementary sense primer 5'CATCTACAACGCTGCC3' and an antisense -β hybrid primer 5'CCGCCTCCTGCGGGCGATGATAGAGAAG3'. The -β hybrid antisense primer has the 3' half of the sequence complementary to and the 5' half complementary to β sequences. The amplification protocol consisted of 20 cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 45 s. 1 µl of the first PCR product was mixed with wild-type β template for the second PCR amplification, the sense primer of the first PCR reaction, and an antisense primer complementary to β 5'AATATTCTGGTACCAGC3'. The amplification protocol consisted of 25 cycles of 94°C for 45 s, 55°C for 50 s, and 72°C for 50 s. CH2 was constructed by amplification of template with a complementary sense primer 5'CATCTACAACGCTGCC3' and an antisense -β hybrid 5'GATCTCCCCAAACTCAATGACACAGACGAC3'. 1 µl of the first PCR reaction was mixed with β template in a second amplification that contained the sense primer of the first reaction and a specific antisense β primer 5'AATATTCTGGTACCAGC3'. CH3 was constructed by amplification of template using a complementary sense primer 5'CATCTACAACGCTGCC3' and an antisense -β hybrid primer 5'GGCCACCCAGGTTGGACAGGAGCATCTC3'. The second PCR amplification used the first PCR sense primer and an antisense primer complementary to β 5'AATATTCTGGTACCAGC3'. For the first PCR of CH4 a sense primer 5'CATCTACAACGCTGCC3' with an antisense -β hybrid primer 5'GATATTTGAGCTCTGGTCCCAGGTGAGAACATT3' were used to amplify template. The second amplification used β template, the same sense primer and an antisense β primer 5'CATCTACAACGCTGCC3'. The products of all the second PCR reactions were digested with two unique restriction enzymes BglII and KpnI, and subcloned into the vector pSD5.
Construction of and β dimers was performed in the following way: The coding regions of the cDNAs of and β subunits were linked to form a single polypeptide by the addition of a unique ClaI site after the last amino acid of the β subunit and before the first methionine of the subunit using PCR. The and β cDNAs were digested with ClaI and ligated into a single cDNA that encodes for the β polypeptide. Construction of and dimer was performed by the addition of a ClaI site at the end of the coding region of the cDNA and immediately before the first methionine of the subunit using PCR. The and cDNAs were digested with ClaI and ligated into a single cDNA that encodes for one polypeptide. The presence of the ClaI site introduced two amino acids (isoleucine and aspartic acid) between β and subunits and between and subunits.
All constructs were sequenced at the Yale facility using an ABI 373 automated DNA sequencer employing dye terminators following a standard protocol supplied by the manufacturer (Applied Biosystems, Inc., Foster City, CA).
|
results |
|---|
|
TopABSTRACTintroductionmethodsresultsdiscussionreferences |
|---|
). We examined the relative permeabilities for Na+ and Li+ of the amiloride-sensitive current in oocytes co-injected with equal amounts of and β or of and cRNAs. The magnitude of the observed amiloride-sensitive sodium current varied from 0.2 to 3 µA, a level of expression adequate for our whole-cell studies. The mean currents were 1.9 ± 0.7 µA for β and 2.7 ± 0.9 µA for . Current-voltage relations were generated in the presence of 150 mM K+, Na+ or Li+ as the gluconate salt in the bathing solution. Membrane potentials were changed in 20 mV incremental steps from –180 to 80 mV. Fig. 1 A shows the relative currents of Na+, Li+, and K+ for channels. Current measurements have been normalized to the amiloride-sensitive Na+ current obtained at –100 mV. At this potential and with this combination of subunits the inward Li+ current was 1.5-fold greater than the Na+ current. There was no significant inward current when the bath contained 150 mM K+. The small outward current at depolarizing membrane potentials is probably carried by Na+ because it is substantially reduced by exposing the cells to Na+ free solutions for 24 h (not shown). Fig. 1 B shows the results of the relative currents through β channels for the same three cations. The Na+ current at –100 mV was 0.8-fold larger than the Li+ mediated current, again with little or no measurable K+ current. Thus, the magnitude of the amiloride-sensitive current of channels is Li+ > Na+ >> K+, a profile similar to that for wild-type β channels (Canessa et al., 1994) and for homomeric channels (Canessa et al., 1993). In contrast, the β channel currents were Na+>Li+>>K+.
|
β and Unitary Currents or β cRNAs. For patch clamp experiments, we selected oocytes that expressed >1 µA of whole-cell current. Fig. 2, A and B, show unitary currents for β and channels, respectively, for a range of holding potentials (–Vp). These records with their long openings and closures are similar to those obtained from β in oocytes (not shown). With 150 mM NaCl in the pipette, the single channel conductance of channels was 6.5 pS (n = 9, Fig. 3 A) and, with 150 mM Li+, was 10.8 pS (n = 5, Fig. 3 A). Thus, the larger unitary conductance for Li+ than for Na+ of channels is similar to β channels (Canessa et al., 1994). In contrast, the single channel conductances of β channels were 5.1 pS (n = 5, Fig. 3 B) for Na+ and 4.2 pS (n = 6, Fig. 3 B) for Li+, therefore the Li+/Na+ current ratio of β is close to 1. The magnitude and Li+/Na+ ratios of unitary currents are in agreement with the data obtained with measurements of whole-cell currents shown in Fig. 1.
|
|
β had average macroscopic currents of 10 µA (ranged from 3 to 12 µA in 20 oocytes) and the number of channels per patch was at least 5. The average whole-cell current of β and injected oocytes was 1.9 (ranged from 0.2 to 2.5 µA in 40 oocytes) and 2.7 µA (ranged from 0.15 to 3.5 µA in 30 oocytes), respectively. The β and patches contained 1–4 channels which is less than the 
5 per patch observed with β. These data indicate that the density of active channels in the plasma membrane of and β injected oocytes is less than that of β injected oocytes. In summary, these results demonstrate that the lower magnitude of whole-cell currents when and or and β are co-expressed, compared with β, is a result of fewer channels in the plasma membrane and not to marked reduction in single channel conductance or open probability.
Inhibition of and β Channels by the Blocker Amiloride and Its Analogues
The epithelial sodium channel is reversibly blocked by the potassium sparing diuretic amiloride (3,5-diamino- N -(aminoiminomethyl) - 6 - chloropyrazinecarboxamide) (Garty and Benos, 1988). The amiloride molecule has a guanidinium group that is positively charged at physiological pH and a pyrazine ring. Aromatic substitutions on the guanidinium moiety (e.g., benzamil or phenamil) increase the potency of the block by approximately 10-fold (Kleyman and Cragoe, 1988). The half maximal concentration of amiloride block (Ki) is in the order of 0.1 µM in the cortical collecting tubule, distal colon, and toad bladder. The amiloride and benzamil Kis of the cloned ENaC measured in oocytes injected with β cRNAs are also 0.1 and 0.01 µM, respectively (Canessa et al., 1994).
We obtained the Ki of amiloride, benzamil, and guanidinium of and β channels by measuring oocyte whole-cell currents after the addition to the bathing solution of increasing concentrations of these blockers from 0.001 to 100 µM (see Fig. 5). These measurements were performed with 150 mM Na+ in the bath solution and with the membrane potential held at –100 mV. For channels the Ki of amiloride was 0.13 ± 0.05 µM (see Fig. 5 A) and the Ki of benzamil was 0.015 ± 0.004 µM (see Fig. 5 B). For β channels the Ki of amiloride was 4 ± 0.4 µM (see Fig. 5 A), and the Ki of benzamil was 0.4 ± 0.09 µM (see Fig. 5 B). Thus, β channels have lower affinity for amiloride and benzamil than channels.
|
). We measured the effectiveness of blockade by guanidinium for and β channels. Fig. 5 C shows that, in contrast to amiloride and benzamil, guanidinium has an equal Ki (10 ± 2.5 mM) for and β channels.
To localize the structural domains that determine amiloride affinity we constructed several chimeric proteins of and β subunits. Fig. 4 shows linear representations of the -β chimeric constructs (CH). M1 and M2 represent the first and second transmembrane domains of the subunit proteins. Sequences corresponding to are shown in white and sequences corresponding to β are shown in black. The numbers at the left and right of the arrows indicate the amino acids of and β subunits at the junction between the two subunits, respectively. We also made the reciprocal β- chimeras that contained the amino terminus of β and the carboxy terminus of . All these constructs were not functional when expressed either alone or when they were co-injected with wild-type subunit (data not shown).
|
-β chimeric constructs co-injected with subunit, only channels containing chimeras CH1 and CH2 showed a high affinity for amiloride with Ki of 0.12 µM. For channels containing CH3 and CH4 the Ki of amiloride was 3.7 ± 0.41 µM (Fig. 5 A), similar to the value observed for β. The transition from high to low amiloride affinity occurred with chimeras CH2 and CH3. CH3 differs from CH2 only by 15 amino acids from the β subunit just proximal to the second transmembrane domain. Therefore, the results obtained with the expression of -β chimeras suggest that a short stretch of the amino acids before the second transmembrane domain of the β subunit are important in determining amiloride affinity.
In contrast to amiloride inhibition, measurements of guanidinium Ki gave similar values for , β, and -chimeric (CH1, CH2, CH3, and CH4) channels indicating that the guanidinium binding site is similar in all these proteins. Since amiloride and benzamil differ from guanidinium in having an attached pyrazine ring, the data indicate the presence of two distinct binding sites in the channel protein; one site for the pyrazine ring and the other site for the guanidinium group.
Since the amiloride block of epithelial sodium channels is known to be voltage dependent (Palmer, 1985; Warncke and Lindemann, 1985), we examined whether the voltage dependence of the block by amiloride was similar in and β channels. For this purpose, we measured the Ki of amiloride at various holding potentials (Ki(V)) ranging from –180 to 50 mV in the presence of only 30 mM Na+ in the bathing solution to enhance the outward currents at positive membrane potentials. Fig. 6 shows the Ki for and β channels normalized to the values obtained at –100 mV and plotted against membrane voltage. The amiloride block of and β channels exhibited virtually identical linear relationships with respect to membrane voltage. We calculated the fraction of the electric field that the blocker traverses to reach the site (
) according to the equation:
 |
|
was 0.133 ± 0.012 for and 0.153 ± 0.002 for β. These values are similar to those reported by Palmer (1985) in toad urinary bladder. From these results, it is reasonable to assume that amiloride senses the same magnitude of the transmembrane electrical field in both types of channels.
It has been shown for wild-type epithelial sodium channels, that external Na+ and amiloride interact competitively, so that the Ki for amiloride increases in the presence of high external sodium concentration. Since and β channels also differ significantly in their Na+ affinity, it was interesting to examine whether the two types of channels exhibit the same competitive effect with external Na+. We measured whole-cell currents in 15, 30, and 150 mM external Na+ at a membrane potential of –100 mV, the ionic strength was kept constant with NMDG gluconate. As shown in Fig. 7, increasing external Na+ concentration from 15 to 150 mM changed the Ki of channels from 0.045 ± 0.005 to 0.104 ± 0.025 µM and that of β channels from 2.11 ± 0.33 to 4.43 ± 0.66 µM. Thus, both and β channels showed a two-fold increase in amiloride Ki for a 10-fold increase in Na+ concentration.
|
and β channels have a similar Ki for guanidinium, a similar voltage dependence of amiloride inhibition, and a similar attenuation of amiloride block by external Na+. These observations are consistent with the notion that the guanidinium group on amiloride interacts with comparable site(s) in the outer mouth of the channel pore of both β and channels.
Apparent Na+ and Li+ Affinities of , β Channels and -β Chimeras
Macroscopic currents of wild-type channels can be described by Michaelis-Menten curves with half-maximal concentrations (Km) of 10–30 mM for Na+ and 30–50 mM for Li+, depending on the tissue and the method of measurements (Olans et al., 1984; Palmer and Frindt, 1988; Puoti et al., 1995). We investigated whether and β channels differ in apparent affinities Km for external Na+ and Li+ ions from wild-type channels. We measured the amiloride-sensitive currents induced by increasing the concentrations of Na+ and Li+ gluconate from 0 to 180 mM in the bathing solution while the membrane potential was held at –100 mV. The results are shown in Fig. 8. We found that channels had an apparent Km of 35 ± 6 mM for Na+ and of 60 ± 5 mM for Li+, values similar to those previously reported for β channels when studied under similar conditions. In contrast, the apparent Km for Na+ and for Li+ of β channels were much larger, estimated values >180 mM. These values represent only an estimation of the actual Km since the largest cation concentration used in these measurements was 180 mM. Further increase in the bath concentration was not tolerated by the oocytes due to the high osmolality of the solution.
|
-β chimeric constructs (CH1 to CH4) exhibit an apparent Km for Na+ and for Li+ (Fig. 4), and ILi+/INa+ at –100 mV (Fig. 1) similar to channels. Channels formed by and CH1 or CH2 showed amiloride Ki and apparent Km for Na+ similar to , whereas channels formed by and CH3 or CH4 showed amiloride Ki similar to β (Fig. 5) but an apparent Km for Na+ similar to channels. The results indicate that in contrast to amiloride, the low apparent Km for external ions in β channels is determined by the first two-thirds of the β subunit.
Effect of Expression of Varied Ratios of ENaC Subunits
In additional experiments we investigated whether the presence of different ratios of and β subunits would result in the formation of channels with different amiloride and cation affinities. For that purpose we co-injected and β cRNAs into oocytes in the following ratios: 1 to 10β; 1 to 5β; 1 to 1β; 5 to 1β; and 10 to 1β. We then examined whether the amiloride Ki or the apparent Km for Na+ of β channels changed in proportion to the ratios of and β subunits. Similar experiments were performed with the corresponding ratios of and subunit cRNAs.
There was no significant difference in either Na+ or Li+ affinities, or in amiloride Ki for the various subunit ratios. This observation indicates that even with an excess of β or subunits, the properties of the expressed channels do not change, suggesting that the stoichiometry of both β and channels is fixed.
The magnitude of Na+ and Li+ amiloride-sensitive currents obtained with the various ratios of / and /β cRNAs are shown in Fig. 9. The largest currents were observed with the 1/1 and 1/1β ratios and the magnitude of the currents decreased progressively when the ratios were made 10/1β or 1/10β (Fig. 9 A) or 10/1 or 1/10 (Fig. 9 B).
|
-dimers that contained all the amino acids of the β subunit linked to all the amino acids of the subunit by the addition of a unique restriction site ClaI that introduced a short linker of two new amino acids: isoleucine and aspartic acid between and β. We also constructed -dimers that contained all the subunit linked to all the subunit by the same two amino acids. The β and -dimers were functional when injected alone in oocytes in the absence of wild-type monomeric subunits. The expressed amiloride-sensitive current was indistinguishable in magnitude and properties from the current induced by co-injection of and β or of and subunits, respectively. When β dimers were co-injected with increasing amounts of or β subunits, or when dimers were co-injected with increasing amounts of or subunits the magnitude of the amiloride-sensitive current did not increase (Fig. 9, C and D). However, co-injection of β-dimers with subunit induced an eight-fold increase in current and changed the Li+/Na+ permeability to >1. Co-injection of -dimers with β subunit also induced a large increment of current without changing the functional properties, indicating that the β- and -dimers appear to be competent for association with and β subunits, respectively to form functional hetero-multimeric channels.
These results suggest that β and channels are formed by a 1:1 ratio of and β and of and subunits, respectively. However, the number of each subunit contributing to functional channels cannot be determined from our data.
|
discussion |
|---|
|
TopABSTRACTintroductionmethodsresultsdiscussionreferences |
|---|
), cyclic nucleotide-gated channels (Bradley et al., 1991; Chen et al., 1993), and certain voltage-gated potassium channels (Isacoff et al., 1990; Krapivinsky et al., 1995) associate their subunits in various combinations to generate different channels, each with unique functional properties. In the present study, we have examined whether the three subunits of ENaC, , β, and , can also associate in various combinations to form channels with distinct functional characteristics. The existence of a diversity of sodium channels is suggested by reports describing amiloride-sensitive sodium channels with properties that do not correspond to those of ENaC (Cantiello et al., 1989; MacGregor et al., 1994; Yue et al., 1994). For instance, it has been shown that in fetal lung epithelial cells there are two populations of amiloride-sensitive sodium channels, one with high affinity (Ki = 0.019 µM) and the other with low affinity (Ki = 1.5 µM) for benzamil (Matalon et al., 1993). Sodium-selective channels with ILi+/INa+ current ratio <1 and relative low amiloride affinity (Ki = 0.87 mM) have been described in membranes of rat macrophages (Negulyaev and Vedernikova, 1994). In the apical membrane of rabbit proximal tubules, amiloride-sensitive highly sodium-selective channels have been observed that have a larger single channel conductance than those present in the distal tubule (Gögelein and Greger, 1986).
These sodium-selective channels may be formed by new subunit proteins from the ENaC family or by combinations of the already known ENaC subunits. Waldmann et al. (1995a) have cloned a subunit that can associate with β and but not with to form functional channels. The ILi+/INa+ ratio of is <1, and the Ki for amiloride is 2.6 µM. These properties are similar to those of β channels. The expression of the subunit overlaps with the expression of , β, and in several tissues including the kidney, although it is not yet known which segments of the nephron express the subunit or whether there is colocalization with the other ENaC subunits to form functional channels in vivo.
Recently, Farman and colleagues (1997) have reported heterogeneity at the level of expression of the subunits of ENaC in respiratory epithelia. A large prevalence of and expression was found in a subpopulation of alveolar cells, in tracheal epithelium as well as in nasal and tracheal gland acini, with little or no β subunit expression. In other tissues, such as the epithelium of the distal colon, the level of expression of individual subunits is highly regulated by aldosterone. Under normal conditions these cells only express the subunit; following stimulation by aldosterone, however, large amounts of β and cRNAs are expressed (Asher et al., 1997). Differential expression of ENaC subunits could represent a mechanism of regulating Na+ reabsorption in tissues. For instance, cells that express only and or , β, and subunits will form channels with high sodium affinity and high amiloride sensitivity, however the maximal capacity for Na+ absorption in and cells will be much smaller than in cells that express simultaneously the three subunits (Canessa et al., 1994). The high affinity for external Na+ of and β channels is important for efficient Na+ absorption in tissues such as the cortical-collecting tubule of the kidney where the luminal Na+ concentration reaches very low levels in states of Na+ depletion. On the other hand, cells that only express and β subunits will form channels with low affinity for Na+, which will limit Na+ absorption unless the concentration of external Na+ is large. Therefore, β channels will only be active when exposed to high Na+ concentrations such as in the lumen of proximal tubules, in the pulmonary airways, or in surrounding macrophages (although the functional significance of ENaC in blood cells is still unknown).
In summary, our results indicate that the ENaC subunits can indeed generate a diversity of channels with different functional and pharmacological characteristics. Epithelial Na+ channels like other multimeric channel proteins have the potential for complex regulation by differential expression of their subunits during development and under the influence of various hormones and stimuli.
Ki of Amiloride
The most specific inhibitor of Na+ channels in high- resistance epithelia is the potassium-sparing diuretic drug amiloride. Several observations indicate that this drug acts by obstructing the conducting pore: (a) it has been demonstrated that the positive charge on the guanidinium moiety is essential for blocking; (b) the Ki of amiloride is sensitive to the luminal Na+ activity indicating an amiloride-ion competition effect; and (c) the channel-amiloride association/dissociation rate constants are voltage dependent. These findings are consistent with the notion that amiloride blocks the channel from the outer part of the conducting pore. However, the molecular site(s) on the channel protein to which the blocker binds has not yet been defined.
We have shown that the amiloride affinity of β channels is significantly lower than that exhibited by β and channels and have presented evidence that a short stretch of 15 amino acids before the second transmembrane domain of the β subunit determines the amiloride Ki of β channels. In spite of a 25-fold difference in amiloride and benzamil Ki of and β, both types of channels exhibited the same affinity for guanidinium with a Ki of 15 mM. The results indicate that the amiloride molecule interacts with the channel protein in at least two distinct sites. At one site, guanidinium binds loosely to the outer pore of the channel. At another distinct site, the pyrazine group binds, increasing the affinity of the blocker by several hundred-fold. Three key observations support the notion that guanidinium binds to a similar site in β and channels: (a) similar guanidinium Ki; (b) a similar electrical distance () sensed by the charged moiety of amiloride; and (c) similar competitive effect of external Na+ on amiloride binding. In contrast, the 25-fold difference in amiloride affinity of and β channels supports the idea that the pyrazine binding site is different in these two channels.
Our results show that β subunits also contribute to determining the amiloride affinity of channels. It is known that subunits are important for amiloride binding, channels formed only by subunits bind amiloride with high affinity, and mutations in the human subunit at positions S598 and S581 decrease the Ki for amiloride (Waldmann et al., 1995b). The region we identified in the β subunit that determines the Ki of amiloride of β channels is highly conserved in all subunits, suggesting that amiloride may also bind to β and , although with different affinity. According to this interpretation amiloride binds to more than one subunit and therefore the arrangement of the subunits around the channel affects the final affinity for amiloride. This notion is consistent with the finding that β channels exhibit high amiloride affinity in spite of having β subunits in their composition. Alternatively, amiloride only makes contact with the subunit but the binding site is modified by the adjacent subunits.
Fig. 10 depicts a model of the outer channel pore where the guanidinium group blocks the entrance of the pore and the pyrazine group makes contact with a second site. The pyrazine binding site is shown between two subunits β or to emphasize the notion that more than one subunit contributes to the site or alternatively, the site formed by the subunit is affected by the neighboring subunits.
|
β and Channelsβ channels are at least 10-fold larger than those for channels. Since these values were derived from whole-cell currents, they represent an ensemble of processes that include single channel conductance, open probability and/or number of conductive channels any of which could change as a function of increasing external cation concentrations. Our present data cannot distinguish between these possibilities. A detailed study of single channel kinetics at different Na+ concentrations is required to establish the different effect of external Na+ in β and channels.
Since channels formed by and chimeras CH1 to CH4 exhibit apparent Km for Na+ similar to channels we can conclude that at least some of the structural determinants of the Km are encoded by the first two-thirds of the β subunit. Similar to the situation with amiloride, where more than one subunit contributes to the amiloride Ki, more than one subunit is also involved in the determination of the apparent Km for Na+: β and channels have a Km for Na+ of 30 mM whereas β have ten fold larger Km values.
Stoichiometry of and β Channels
All three subunits, , β, and , associate to form ENaC although the number of subunits and their stoichiometry are presently unknown. We have examined the composition of channels formed only by two subunits, and β, and and , and whether the functional properties of these channels can be modified by injecting various ratios of the cRNAs. Varying the ratio of injected cRNA's between 0.1 and 10 did not change the properties of β or channels. The largest amplitude of whole-cell amiloride-sensitive currents were obtained with ratios 1:1β and 1:1. These results suggest a most likely stoichiometry of 1:1β and of 1:1 for β and for channels, respectively. In addition, expression of β-dimers and -dimers induced currents with properties indistinguishable from those induced by injection of single subunits, and the whole-cell currents were of similar magnitude than those induced by co- injection of single subunits with a 1:1 ratio. Since the addition of single subunits to the dimers did not increase the current, it seems likely that β and channels have an even number of subunits, either 4, 6, or more; our data can not discriminate among these possibilities.
In conclusion, the results of these studies indicate that the stoichiometry and the order of the subunits around the pore are structural features that define the functional properties of the channel; when they are altered the properties of the channels such as amiloride affinity, apparent Km for Na+, INa+/ILi+ ratio are also changed.
1 Abbreviations used in this paper: CH, chimeric constructs; ENaC, epithelial Na+ channel; NMDG, N-methyl-D-glucamine.
|
ACKNOWLEDGMENTS |
|---|
Submitted: 25 July 1996
Accepted: 19 March 1997
|
references |
|---|
|
TopABSTRACTintroductionmethodsresultsdiscussionreferences |
|---|
i-3, activates a pertussis toxin-sensitive Na+channel from the epithelial cell line, A6, J Biol Chem, 1989, 264, 20867–20870., β and subunit mRNAs of the epithelial sodium channel along the rat respiratory tract, Am J Physiol, 1997, 272, C131–C141.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  C. Yang, L. Su, Y. Wang, and L. Liu UTP regulation of ion transport in alveolar epithelial cells involves distinct mechanisms Am J Physiol Lung Cell Mol Physiol, September 1, 2009; 297(3): L439 - L454. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-L. Ji, W. Song, Z. Gao, X.-F. Su, H.-G. Nie, Y. Jiang, J.-B. Peng, Y.-X. He, Y. Liao, Y.-J. Zhou, et al. SARS-CoV proteins decrease levels and activity of human ENaC via activation of distinct PKC isoforms Am J Physiol Lung Cell Mol Physiol, March 1, 2009; 296(3): L372 - L383. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. H. Kim, K. X. Kim, N. N. Raveendran, T. Wu, S. R. Pondugula, and D. C. Marcus Regulation of ENaC-mediated sodium transport by glucocorticoids in Reissner's membrane epithelium Am J Physiol Cell Physiol, March 1, 2009; 296(3): C544 - C557. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Diakov, K. Bera, M. Mokrushina, B. Krueger, and C. Korbmacher Cleavage in the {gamma}-subunit of the epithelial sodium channel (ENaC) plays an important role in the proteolytic activation of near-silent channels J. Physiol., October 1, 2008; 586(19): 4587 - 4608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. O'Brodovich, P. Yang, S. Gandhi, and G. Otulakowski Amiloride-insensitive Na+ and fluid absorption in the mammalian distal lung Am J Physiol Lung Cell Mol Physiol, March 1, 2008; 294(3): L401 - L408. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Pochynyuk, Q. Tong, J. Medina, A. Vandewalle, A. Staruschenko, V. Bugaj, and J. D. Stockand Molecular Determinants of PI(4,5)P2 and PI(3,4,5)P3 Regulation of the Epithelial Na+ Channel J. Gen. Physiol., September 24, 2007; 130(4): 399 - 413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Pochynyuk, Q. Tong, A. Staruschenko, and J. D. Stockand Binding and direct activation of the epithelial Na+ channel (ENaC) by phosphatidylinositides J. Physiol., April 15, 2007; 580(2): 365 - 372. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Brown, S. M. Fernandez-Illescas, Z. Liao, and M. B. Goodman Gain-of-Function Mutations in the MEC-4 DEG/ENaC Sensory Mechanotransduction Channel Alter Gating and Drug Blockade J. Gen. Physiol., January 29, 2007; 129(2): 161 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Malik, S. R. Price, W. E. Mitch, Q. Yue, and D. C. Eaton Regulation of epithelial sodium channels by the ubiquitin-proteasome proteolytic pathway Am J Physiol Renal Physiol, June 1, 2006; 290(6): F1285 - F1294. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-L. Ji, X.-F. Su, S. Kedar, J. Li, P. Barbry, P. R. Smith, S. Matalon, and D. J. Benos {delta}-Subunit Confers Novel Biophysical Features to {alpha}beta{gamma}-Human Epithelial Sodium Channel (ENaC) via a Physical Interaction J. Biol. Chem., March 24, 2006; 281(12): 8233 - 8241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Amin, H.-W. Wang, E. Reza, S. C. Whitman, B. S. Tuana, and F. H. H. Leenen Distribution of epithelial sodium channels and mineralocorticoid receptors in cardiovascular regulatory centers in rat brain Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2005; 289(6): R1787 - R1797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. M. Mutlu and J. I. Sznajder Mechanisms of pulmonary edema clearance Am J Physiol Lung Cell Mol Physiol, November 1, 2005; 289(5): L685 - L695. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. B. Kashlan, S. Sheng, and T. R. Kleyman On the Interaction between Amiloride and Its Putative {alpha}-Subunit Epithelial Na+ Channel Binding Site J. Biol. Chem., July 15, 2005; 280(28): 26206 - 26215. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Volk, R. F. Husted, R. D. Sigmund, and J. B. Stokes Overexpression of the Epithelial Na+ Channel {gamma} Subunit in Collecting Duct Cells: INTERACTIONS OF LIDDLE'S MUTATIONS AND STEROIDS ON EXPRESSION AND FUNCTION J. Biol. Chem., May 6, 2005; 280(18): 18348 - 18354. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Niisato, D. C. Eaton, and Y. Marunaka Involvement of cytosolic Cl- in osmoregulation of {alpha}-ENaC gene expression Am J Physiol Renal Physiol, November 1, 2004; 287(5): F932 - F939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Paukert, E. Babini, M. Pusch, and S. Grunder Identification of the Ca2+ Blocking Site of Acid-sensing Ion Channel (ASIC) 1: Implications for Channel Gating J. Gen. Physiol., September 27, 2004; 124(4): 383 - 394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Staruschenko, J. L. Medina, P. Patel, M. S. Shapiro, R. E. Booth, and J. D. Stockand Fluorescence Resonance Energy Transfer Analysis of Subunit Stoichiometry of the Epithelial Na+ Channel J. Biol. Chem., June 25, 2004; 279(26): 27729 - 27734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. Hardiman, C. M. McNicholas-Bevensee, J. Fortenberry, C. T. Myles, B. Malik, D. C. Eaton, and S. Matalon Regulation of Amiloride-Sensitive Na+ Transport by Basal Nitric Oxide Am. J. Respir. Cell Mol. Biol., May 1, 2004; 30(5): 720 - 728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Helve, O. M. Pitkanen, S. Andersson, H. O'Brodovich, T. Kirjavainen, and G. Otulakowski Low Expression of Human Epithelial Sodium Channel in Airway Epithelium of Preterm Infants With Respiratory Distress Pediatrics, May 1, 2004; 113(5): 1267 - 1272. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-L. Ji, L. R. Bishop, S. J. Anderson, C. M. Fuller, and D. J. Benos The Role of Pre-H2 Domains of {alpha}- and {delta}-Epithelial Na+ Channels in Ion Permeation, Conductance, and Amiloride Sensitivity J. Biol. Chem., February 27, 2004; 279(9): 8428 - 8440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Inagaki, S. Yamaguchi, and T. Ishikawa Amiloride-sensitive epithelial Na+ channel currents in surface cells of rat rectal colon Am J Physiol Cell Physiol, February 1, 2004; 286(2): C380 - C390. [Abstract] [Full Text]
|
|
|
|
 |
|
 D. C. Eaton, J. Chen, S. Ramosevac, S. Matalon, and L. Jain Regulation of Na+ Channels in Lung Alveolar Type II Epithelial Cells Proceedings of the ATS, January 1, 2004; 1(1): 10 - 16. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Kelly, C. Lin, M. Ramkumar, N. C. Saxena, T. R. Kleyman, and D. C. Eaton Characterization of an amiloride binding region in the {alpha}-subunit of ENaC Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1279 - F1290. [Abstract] [Full Text]
|
|
|
|
|
|
J. Frank, J. Roux, H. Kawakatsu, G. Su, A. Dagenais, Y. Berthiaume, M. Howard, C. M. Canessa, X. Fang, D. Sheppard, et al. Transforming Growth Factor-{beta}1 Decreases Expression of the Epithelial Sodium Channel {alpha}ENaC and Alveolar Epithelial Vectorial Sodium and Fluid Transport via an ERK1/2-dependent Mechanism J. Biol. Chem., November 7, 2003; 278(45): 43939 - 43950. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. A. Weisz and J. P. Johnson Noncoordinate regulation of ENaC: paradigm lost? Am J Physiol Renal Physiol, November 1, 2003; 285(5): F833 - F842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. E. Booth, Q. Tong, J. Medina, P. M. Snyder, P. Patel, and J. D. Stockand A Region Directly Following the Second Transmembrane Domain in {gamma}ENaC Is Required for Normal Channel Gating J. Biol. Chem., October 17, 2003; 278(42): 41367 - 41379. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Kellenberger, I. Gautschi, and L. Schild Mutations in the Epithelial Na+ Channel ENaC Outer Pore Disrupt Amiloride Block by Increasing Its Dissociation Rate Mol. Pharmacol., October 1, 2003; 64(4): 848 - 856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. E. Booth and J. D. Stockand Targeted degradation of ENaC in response to PKC activation of the ERK1/2 cascade Am J Physiol Renal Physiol, May 1, 2003; 284(5): F938 - F947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Rohatgi, A. Greenberg, C. R. Burrow, P. D. Wilson, and L. M. Satlin Na Transport in Autosomal Recessive Polycystic Kidney Disease (ARPKD) Cyst Lining Epithelial Cells J. Am. Soc. Nephrol., April 1, 2003; 14(4): 827 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-A. Konstas and C. Korbmacher The gamma -subunit of ENaC is more important for channel surface expression than the beta -subunit Am J Physiol Cell Physiol, February 1, 2003; 284(2): C447 - C456. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. G. Shlyonsky, F. Mies, and S. Sariban-Sohraby Epithelial sodium channel activity in detergent-resistant membrane microdomains Am J Physiol Renal Physiol, January 1, 2003; 284(1): F182 - F188. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Hendron, P. Patel, M. Hausenfluke, N. Gamper, M. S. Shapiro, R. E. Booth, and J. D. Stockand Identification of Cytoplasmic Domains within the Epithelial Na+ Channel Reactive at the Plasma Membrane J. Biol. Chem., September 6, 2002; 277(37): 34480 - 34488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Bonny and B. C. Rossier Disturbances of Na/K Balance: Pseudohypoaldosteronism Revisited J. Am. Soc. Nephrol., September 1, 2002; 13(9): 2399 - 2414. [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Matthay, H. G. Folkesson, and C. Clerici Lung Epithelial Fluid Transport and the Resolution of Pulmonary Edema Physiol Rev, July 1, 2002; 82(3): 569 - 600. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kellenberger and L. Schild Epithelial Sodium Channel/Degenerin Family of Ion Channels: A Variety of Functions for a Shared Structure Physiol Rev, July 1, 2002; 82(3): 735 - 767. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Couloigner, M. Fay, S. Djelidi, N. Farman, B. Escoubet, I. Runembert, O. Sterkers, G. Friedlander, and E. Ferrary Location and function of the epithelial Na channel in the cochlea Am J Physiol Renal Physiol, February 1, 2001; 280(2): F214 - F222. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. M. PITKÄNEN, D. SMITH, H. O'BRODOVICH, and G. OTULAKOWSKI Expression of {alpha}-, {beta}-, and {gamma}-hENaC mRNA in the Human Nasal, Bronchial, and Distal Lung Epithelium Am. J. Respir. Crit. Care Med., January 1, 2001; 163(1): 273 - 276. [Abstract] [Full Text]
|
|
|
|
|
|
A. Lazrak, A. Samanta, K. Venetsanou, P. Barbry, and S. Matalon Modification of biophysical properties of lung epithelial Na+ channels by dexamethasone Am J Physiol Cell Physiol, September 1, 2000; 279(3): C762 - C770. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C Jeziorski, K. A Green, J. Sommerville, and G. A Cottrell Cloning and expression of a FMRFamide-gated Na+ channel from Helisoma trivolvis and comparison with the native neuronal channel J. Physiol., July 1, 2000; 526(1): 13 - 25. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Lewis Everything you wanted to know about the bladder epithelium but were afraid to ask Am J Physiol Renal Physiol, June 1, 2000; 278(6): F867 - F874. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Lazrak, A. Samanta, and S. Matalon Biophysical properties and molecular characterization of amiloride-sensitive sodium channels in A549 cells Am J Physiol Lung Cell Mol Physiol, April 1, 2000; 278(4): L848 - L857. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. de la Rosa, P. Zhang, A. Naray-Fejes-Toth, G. Fejes-Toth, and C. M. Canessa The Serum and Glucocorticoid Kinase sgk Increases the Abundance of Epithelial Sodium Channels in the Plasma Membrane of Xenopus Oocytes J. Biol. Chem., December 31, 1999; 274(53): 37834 - 37839. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Jovov, A. Tousson, H.-L. Ji, D. Keeton, V. Shlyonsky, P.-J. Ripoll, C. M. Fuller, and D. J. Benos Regulation of Epithelial Na+ Channels by Actin in Planar Lipid Bilayers and in the Xenopus Oocyte Expression System J. Biol. Chem., December 31, 1999; 274(53): 37845 - 37854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. K. Fyfe, P. Zhang, and C. M. Canessa The Second Hydrophobic Domain Contributes to the Kinetic Properties of Epithelial Sodium Channels J. Biol. Chem., December 17, 1999; 274(51): 36415 - 36421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Kemp, Z. Borok, K. J. Kim, R. L. Lubman, S. I. Danto, and E. D. Crandall Epidermal growth factor regulation in adult rat alveolar type II cells of amiloride-sensitive cation channels Am J Physiol Cell Physiol, December 1, 1999; 277(6): C1058 - C1065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Chalfant, J. S. Denton, A. L. Langloh, K. H. Karlson, J. Loffing, D. J. Benos, and B. A. Stanton The NH2 Terminus of the Epithelial Sodium Channel Contains an Endocytic Motif J. Biol. Chem., November 12, 1999; 274(46): 32889 - 32896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. J Benos and B. A Stanton Functional domains within the degenerin/epithelial sodium channel (Deg/ENaC) superfamily of ion channels J. Physiol., November 1, 1999; 520(3): 631 - 644. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. M. Snyder, D. R. Olson, and D. B. Bucher A Pore Segment in DEG/ENaC Na+ Channels J. Biol. Chem., October 1, 1999; 274(40): 28484 - 28490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Zeiske, I. Smets, M. Ameloot, P. Steels, and W. van Driessche Intracellular pH shifts in cultured kidney (A6) cells: effects on apical Na+ transport Am J Physiol Cell Physiol, September 1, 1999; 277(3): C469 - C479. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A Green and G. A Cottrell Block of the Helix FMRFamide-gated Na+ channel by FMRFamide and its analogues J. Physiol., August 15, 1999; 519(1): 47 - 56. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. H. Lin, M. D. Zentner, H.-L. L. Ho, K.-J. Kim, and D. K. Ann The Gene Expression of the Amiloride-sensitive Epithelial Sodium Channel alpha -Subunit Is Regulated by Antagonistic Effects between Glucocorticoid Hormone and Ras Pathways in Salivary Epithelial Cells J. Biol. Chem., July 30, 1999; 274(31): 21544 - 21554. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Adams, P. M. Snyder, and M. J. Welsh Paradoxical Stimulation of a DEG/ENaC Channel by Amiloride J. Biol. Chem., May 28, 1999; 274(22): 15500 - 15504. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Talbot, D. G. Bosworth, E. L. Briley, D. A. Fenstermacher, R. C. Boucher, S. E. Gabriel, and P. M. Barker Quantitation and Localization of ENaC Subunit Expression in Fetal, Newborn, and Adult Mouse Lung Am. J. Respir. Cell Mol. Biol., March 1, 1999; 20(3): 398 - 406. [Abstract] [Full Text]
|
|
|
|
 |
|
 M Brouard, M Casado, S Djelidi, Y Barrandon, and N Farman Epithelial sodium channel in human epidermal keratinocytes: expression of its subunits and relation to sodium transport and differentiation J. Cell Sci., January 10, 1999; 112(19): 3343 - 3352. [Abstract] [PDF]
|
|
|
|
|
|
U. C. Kopp, K. Matsushita, R. D. Sigmund, L. A. Smith, S. Watanabe, and J. B. Stokes Amiloride-sensitive Na+ channels in pelvic uroepithelium involved in renal sensory receptor activation Am J Physiol Regulatory Integrative Comp Physiol, December 1, 1998; 275(6): R1780 - R1792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. A. Valentijn, G. K. Fyfe, and C. M. Canessa Biosynthesis and Processing of Epithelial Sodium Channels in Xenopus Oocytes J. Biol. Chem., November 13, 1998; 273(46): 30344 - 30351. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. K. Fyfe and C. M. Canessa Subunit Composition Determines the Single Channel Kinetics of the Epithelial Sodium Channel J. Gen. Physiol., October 1, 1998; 112(4): 423 - 432. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. OTULAKOWSKI, S. FLUECKIGER-STAUB, L. ELLIS, K. RAMLALL, O. STAUB, D. SMITH, P. DURIE, and H. O'BRODOVICH Relation between alpha , beta , and gamma Human Amiloride- Sensitive Epithelial Na+ Channel mRNA Levels and Nasal Epithelial Potential Difference in Healthy Men Am. J. Respir. Crit. Care Med., October 1, 1998; 158(4): 1213 - 1220. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Cheng, L. S. Prince, P. M. Snyder, and M. J. Welsh Assembly of the Epithelial Na+ Channel Evaluated Using Sucrose Gradient Sedimentation Analysis J. Biol. Chem., August 28, 1998; 273(35): 22693 - 22700. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ishikawa, Y. Marunaka, and D. Rotin Electrophysiological Characterization of the Rat Epithelial Na+ Channel (rENaC) Expressed in MDCK Cells: Effects of Na+ and Ca2+ J. Gen. Physiol., June 1, 1998; 111(6): 825 - 846. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Kosari, S. Sheng, J. Li, D.-O. D. Mak, J. K. Foskett, and T. R. Kleyman Subunit Stoichiometry of the Epithelial Sodium Channel J. Biol. Chem., May 29, 1998; 273(22): 13469 - 13474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Coscoy, E. Lingueglia, M. Lazdunski, and P. Barbry The Phe-Met-Arg-Phe-amide-activated Sodium Channel Is a Tetramer J. Biol. Chem., April 3, 1998; 273(14): 8317 - 8322. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. G. Palmer Epithelial Na Channels: Why All the Subunits? J. Gen. Physiol., June 1, 1997; 109(6): 675 - 676. [Full Text] [PDF]
|
|
|
|
|
|
O. A. Weisz, J.-M. Wang, R. S. Edinger, and J. P. Johnson Non-coordinate Regulation of Endogenous Epithelial Sodium Channel (ENaC) Subunit Expression at the Apical Membrane of A6 Cells in Response to Various Transporting Conditions J. Biol. Chem., December 15, 2000; 275(51): 39886 - 39893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. A. Itani, S. D. Auerbach, R. F. Husted, K. A. Volk, S. Ageloff, M. A. Knepper, J. B. Stokes, and C. P. Thomas Alveolar Epithelial Ion and Fluid Transport: Glucocorticoid-stimulated lung epithelial Na+ transport is associated with regulated ENaC and sgk1 expression Am J Physiol Lung Cell Mol Physiol, April 1, 2002; 282(4): L631 - L641. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
), 
). Similar response to CH3 was obtained with chimera CH4. Measurements were obtained with the two-electrode voltage clamp technique in the presence of 150 mM Na+ gluconate in the bath and at –100 mV membrane potential. Data points represent the mean of 10 different oocytes. Vertical bars represent the SEM.
